Please enable it to take advantage of the complete set of features! 4, supporting the importance of endogenous FOXCs in converting human fibroblasts into ECs by transducing ETV2. The ETS-related transcription factor 2 (ETV2) is a transcription factor that is both necessary and sufficient for the development of endothelial and blood lineages. Secreted FGFR3, but not FGFR1, inhibits lens fiber differentiation. Preliminary data : if you are an author who wish to write a full paper/card on this gene, contribute in submission tool. Rho GTPases at the crossroad of signaling networks in mammals: impact of Rho-GTPases on microtubule organization and dynamics. Curr Opin Genet Dev. Epub 2015 Mar 23. We have characterized the Xenopus orthologue of the ETS transcription factor, ETV2. 2022 Feb 14;13:814291. doi: 10.3389/fgene.2022.814291. In coordination with endogenous FOXC2 in fibroblasts, transduced ETV2 elicits expression of multiple key endothelial development factors, including FLI1, ERG, (H) Hematoxylin and eosin staining of the adductor muscles of ischemic limbs. Despite numerous efforts over the past few decades, the number of the patients with cardiovascular disease still remains high, thereby necessitating the development of novel therapeutic strategies equipped with a better understanding of the biology of the cardiovascular system. ETV2 (Ets variant transcription factor 2), an Ets-related transcription factor, is expressed transiently in primitive angioblasts and regulates hematoendothelial lineage Curr Top Dev Biol. 8600 Rockville Pike Lens fiber differentiation proceeds in. The ETS Factor, ETV2: a Master Regulator for Vascular Endothelial Cell Development. B, Quantification of migration in iHA-Etv2 MEFs in the conditions described in (A). 3 (Figure VII in the Data Supplement). Unable to load your collection due to an error, Unable to load your delegates due to an error. Our data revealed that Dox-mediated overexpression of ETV2 resulted in a robust (10-fold) increase in the level of Rhoj transcripts (Figure 4B; n=3 replicates; **P<0.01). Despite the differences in expression pattern between HAFs and ETVECs, there were no apparent differences in murine EC incorporation into the muscles (SI Appendix, Fig. Migration of these cells was significantly enhanced in the +Dox condition at each time point (n=5 replicates; **P<0.01). Vierbuchen T, Wernig M. Molecular roadblocks for cellular reprogramming. ); the Mochida Memorial Foundation (R.M. In addition, some of the Venus+ HFL-1 cells demonstrated acetylated low-density lipoprotein (AcLDL) uptake in a punctuate staining pattern characteristic of ECs (2) (SI Appendix, Fig. For the bioinformatics analyses, significance was determined by using the Fisher Exact Test. Gene expression levels are relative to HPRT1. Unauthorized Liu F, Li D, Yu YY, Kang I, Cha MJ, Kim JY, Park C, Watson DK, Wang T, Choi K. EMBO Rep. 2015 May;16(5):654-69. doi: 10.15252/embr.201439939. National Library of Medicine Each well was imaged every 6-hour period at the same region of the well. American Heart Association, Inc. All rights reserved. Epub 2014 Sep 3. Our results indicated that Rhoj transcripts were robustly expressed in the zsGreen+ cell populations compared with zsGreen cells at D3 and D4 of differentiation (Figure 3F; n=3 replicates; *P<0.05). F30 HL152561/HL/NHLBI NIH HHS/United States, R01 HL144582/HL/NHLBI NIH HHS/United States, Ye, L., Zimmermann, W.-H., Garry, D. J. 2022 Sep 9;50(16):e91. Li J, et al. C, Migration assays with iHA-Etv2 ESCs in the absence (Dox) and presence (+Dox) of doxycycline for a 24-h period (n=4 replicates). The accumulative data indicate that ETV2, an ETS transcription factor, performs a potent and indispensable function in mediating vessel development. 6 I and J). PMC Total RNA was isolated from MEFs, FACS-sorted cells (25000 cells), or cells from EBs using the RNeasy kit (Qiagen) according to the manufacturers protocol. Erg (v-ets avian erythroblastosis virus E26 oncogene homolog) associates with Klf2 to induce proto-oncogene Flk1 expression during vascular development (14); Fli1 acts early in hemangioblast development by functioning upstream of many early endothelial genes, including Tal1 and Gata (15); and ets variant 2 (Etv2) is essential for the specification of endothelial and hematopoietic lineages early in gestation (16). NCI CPTC Antibody Characterization Program. Basic and Translational Research in Cardiac Repair and Regeneration: JACCState-of-the-ArtReview. Our recent findings defined a role for ETV2 in the regulation of Yes1 gene expression and the Hippo signaling pathway during embryogenesis.5 In a context-dependent fashion, we demonstrated that ETV2 also regulated cell proliferation. sharing sensitive information, make sure youre on a federal Consequently, whereas the expression intensity of induced ETV2 and endogenous FLI1 in HAFs depended on the Dox concentration, endogenous ERG expression levels in HAFs did not increase at higher Dox concentrations (Fig. ER71 acts downstream of BMP, Notch, and Wnt signaling in blood and vessel progenitor specification. Figure 5. Nat Biomed Eng. Quantitative RT-PCR analysis revealed that HAFs expressed both endogenous FOXC1 and FOXC2 mRNAs, and that FOXC2 expression was higher than FOXC1 expression (Fig. Details are provided in SI Appendix, SI Text. Would you like email updates of new search results? The .gov means its official. Federal government websites often end in .gov or .mil. Whereas HAFs expressed FGF2 and VEGFA, but not CSF3, ETVECs showed an opposite expression pattern of these angiogenic growth factors, as with the case of HUVECs (27) (SI Appendix, Fig. Consequently, at 10 d after ETVECs were cultured without Dox on day 21, 10% of these ETVECs expressed CD31 and VE-cadherin at the same levels as ETVECs continuously exposed to Dox (Fig. To verify whether the rescue of perturbed migration was because of an ETV2-Rhoj network, we undertook qPCR experiments. Direct Reprogramming of Human Dermal Fibroblasts Into Endothelial Cells Using ER71/ETV2. Gated on 7-AADVenus+ cells. -, Lugano, R., Ramachandran, M. & Dimberg, A. Tumor angiogenesis: causes, consequences, challenges and opportunities. The new PMC design is here! These isolated cells (iHA-Etv2 MEFs) from Rosa26-rtTA;TRE-iHA-Etv2 embryos robustly expressed ETV2 following the addition of doxycycline (Figure III in the Data Supplement). Email. Subsequently, 15 L protein G-dynabeads were added and incubated for 15 minutes at room temperature. Print 2021 Jun. Next, we undertook qPCR analysis using RNA isolated from FACS-sorted EYFP and EYFP+ cells from Etv2-EYFP E8.5 transgenic mouse embryos. The wells were washed twice with PBS followed by culturing the cells in the absence (Dox) and presence (+Dox) of doxycycline for a 24-hour period in the ES culture media containing 15% FBS, 2 mmol/L Glutamax, 1X penicillin/streptomycin, 0.1 mmol/L -mercaptoethanol, and 1000 U/mL LIF (Millipore), at 37C in 5% CO2. At 28 d after implantation, ETVECs, but not HAFs, formed vasculature that was recognized not only by a human CD34-specific mAb, but also by Ulexeuropaeus agglutinin I (UEA I) that binds to human, but not murine, ECs (1, 24) (Fig. (BD) Fifteen days later, Venus+ cells were subjected to quantitative RT-PCR analysis (B) and flow cytometry analysis (C and D). Accessibility Initially, we analyzed the ETV2 ChIP-seq dataset22 and found a strong peak in the promoter region of the Rhoj gene. These results supported the hypothesis that Rhoj is a downstream effector of ETV2 and is important in the regulation of endothelial progenitor cell migration. To evaluate the angiogenic potential of ETVECs in vivo, we implanted Matrigel-suspended ETVECs and HAFs s.c. into NOD SCID mice. We and others have shown that ETV2 is expressed in the earliest hematoendothelial progenitors.13,15 These endothelial progenitors migrate to and from the primary vascular plexus in a coordinated fashion.31 Importantly, in the absence of Etv2, progenitors (identified using the Etv2-EYFP transgenic reporter mouse model) were shown to be present but mislocalized supporting the notion that ETV2 has a role in cell migration. Please enable it to take advantage of the complete set of features! The ETS transcription factor Etv2 has proven to be essential for hematopoietic and vascular development. Angiogenesis. Doxycycline (1 g/mL) was added to iHA-Etv2 MEFs for migration assays and transcriptional analysis. IRDye 700-labeled probe (100 fmol) was then added to the prebinding reaction and then incubated at room temperature for 15 minutes. Here we report that ETV2 functions as a pioneer factor that relaxes closed chromatin and regulates endothelial development. Suppression of MAPK/JNK-MTORC1 signaling leads to premature loss of organelles and nuclei by autophagy during terminal differentiation of Lens fiber cells. The following oligonucleotides sequences were used for the Electrophoretic Mobility Shift Assay experiment. 1], Figure 5D [site No. Thus, creating ECs from nonvascular cells by transducing some transcription factors not only leads to the development of new strategies for patient-specific therapeutic angiogenesis, but also facilitates the maintenance of the solid organs that are regenerated from pluripotent stem cells. 1 Mutant Strand18 unlabeled: GGGATAAAGCttcAAGTTTGACAGC; Site No. -, Basu S, Rajakaruna S, Reyes B, Van Bockstaele E, Menko AS. Preliminary data : if you are an author who wish to write a full paper/card on this gene, contribute in submission tool Other Information Locus ID: NCBI: 2116 MIM: 609358 HGNC: 3491 Ensembl: An analysis of the EC subset markers showed that ETVECs expressed the venous EC markers NRP2, NR2F2, and EPHB4, but not the arterial EC marker EFNB2 or lymphatic EC marker PROX1 (SI Appendix, Fig. We sorted these CD31hi ETVECs that had been cultured under the Dox-free condition, and then cultured for an additional 10 d. Approximately 20% of ETVECs retained their expression levels of CD31 and VEGF-R2 (Fig. J Clin Invest. 6 B and D). Bookshelf Revolutionizing cardiovascular medicine: targeted therapies for the cardiac conduction system. Before All animal studies were approved by the Institutional Animal Care and Use Committee at the University of Minnesota. iPSCs are an especially promising source for creating ECs, although the main limitation of applying iPSCs is the risk of incomplete differentiation and tumorigenicity (4, 5). Moreover, the combined analysis of RNAseq, ChIP-seq, and ATAC-seq data showed that the genes upregulated following ETV2 overexpression were significantly associated with cell mobility, cell migration, RhoA signaling, and Rho GTPase related function and consistently have more ETV2 ChIP-seq peaks and ATAC-seq peaks near the TSS region (Figure 1D and 1E). Here, we examined a family of FGF-induced SRTFs - Etv1, Etv 4, and Etv 5 - in murine lens development. 2 Mutant Strand18 unlabeled: GGAATGCAGCttcAAACCCACGATT; Site No. Because they down-regulated the expression of a fibroblast marker, COL1A2 (SI Appendix, Fig. All experiments were repeated at least 3, and values presented are meanSEM. Before The sonicated lysate was centrifuged for 10 minutes at 16000g at 4C and 150 L 10% Triton X-100 was added to the soluble lysate. In contrast, i.m. In the present study, we define a new role for ETV2 as a regulator of cell migration. Anderson Cancer Center) for the human FOXC2 shRNA vectors, and R. Komine for determining CD31 expression of clones. To identify human endothelial fate-inducing factors, we cloned a total of 18 transcription factors (TFs) (SI Appendix, Table S1) that are important for both endothelial and hematopoietic development. We then analyzed ETV2 chromatin immunoprecipitation-seq and assay for transposase accessible chromatin-seq datasets, which showed enrichment of chromatin immunoprecipitation-seq peaks with increased chromatin accessibility in migratory genes following overexpression of ETV2. PMC -, Bassnett S, Shi Y, Vrensen GFJM. 1H), but not hematopoietic cell markers PTPRC (CD45) and ITGA2B (CD41) (SI Appendix, Fig. Front Genet. 5C) and exhibited a cobblestone-like morphology (Fig. Figure 6.. Etv induces Jag1 expression to. 3 were most effective at knocking down Rhoj (Figure VII in the Data Supplement). These results demonstrate that transient ETV2 expression is sufficient to directly convert part of HAFs into ETVECs that stably maintain EC properties. Cell 151, 559575 (2012). Figure 7figure supplement 1.. wrote the paper. about navigating our updated article layout. Moreover, the expression of Rhoj transcript paralleled the expression of Etv2 during ESC/EB differentiation23 (Figure V in the Data Supplement ). 1A, green line) that expressed ETV2 at intermediate levels yielded some AcLDL uptake-positive and CD31+ cells (Fig. HHS Vulnerability Disclosure, Help Disclaimer, National Library of Medicine A P0.05 was considered a significant change and was highlighted in each panel by an asterisk. To determine which ETV2 domain is essential for the EC induction, we constructed four types of HA-tagged ETV2 truncations for lentivirus vectors (SI Appendix, Fig. 6C). More recently, ETV2 has been reported to transdifferentiate skeletal muscle into functional ECs in zebrafish (30). Here, by screening 18 transcription factors that are important for both endothelial and hematopoietic development, we demonstrate that ets variant 2 (ETV2) alone directly converts primary human adult skin fibroblasts into functional vascular endothelial cells (ETVECs). Here, by screening 18 transcription factors that are important for both endothelial and hematopoietic development, we demonstrate that ets variant 2 (ETV2) R01 HL119291/HL/NHLBI NIH HHS/United States, Hollenhorst PC, McIntosh LP, Graves BJ. 2A). ETVECs represent proliferative ECs. Overexpression of ETV2 led to a robust increase in Rhoj in both embryoid bodies and mouse embryonic fibroblasts, whereas, its expression was abolished in the Etv2 knockout embryoid bodies. Epub 2015 May 21. By continuing to browse this site you are agreeing to our use of cookies. 113, 922932 (2013). ChIP assay using an intergenic region was performed to validate the specificity. (C) Photos of the two representative EC colonies at 20 d after the culture with or without Dox. Bookshelf 2 WT Strand18 unlabeled: GGAATGCAGCAGGAAACCCACGATT; Site No. Curr Top Dev Biol. (F and G) Quantitative RT-PCR for transcription factors (F) and EC effector molecules (G) performed with HAFs (black), ETVECs (pink), and HUVECs (blue). We found higher expression of Rhoj following ETV2 overexpression and intermediate expression following coexpression of ETV2 and Rhoj shRNA compared with control conditions (Figure 6C; n=3 replicates; **P<0.01). The size of the dot indicates the number of the genes annotated with corresponding GO terms, and the color of the dot indicates the P of the Fisher exact test of the pathway analysis. Ann N Y Acad Sci. Thus, transcription factors specialized in direct conversion of human fibroblasts into ECs need to be explored. Fluorescence was detected using an Odyssey CLx imager (LI-COR Biosciences, Lincoln, NE). Red and blue lines indicate targets and isotype controls, respectively. S1E). Please enable it to take advantage of the complete set of features! 2116. The protocol used for electrophoretic mobility shift assay was previously described.5 Briefly, HA-tagged ETV2 was synthesized using pcDNA3.1-Etv2-HA vectors using the TNT Quick Coupled Transcription/Translation System (Promega, Madison, WI) according to the manufacturers protocol. Dallas, TX 75231 B and C, Venn diagram of the overlap between genes associated with (B) ETV2 chromatin immunoprecipitation (ChIP)-seq peaks and (C) EB D3 ATAC-seq peaks and genes annotated to cell migration (GO:0048870). Thus, we consider HOPX to be incidentally expressed in HFL-ECs. Note the enrichment of Etv2 but not Ets1 transcripts in the Flk1+/Pdgfra (lateral plate mesoderm) cells relative to the negative populations (n=3 replicates; *P<0.05). Significance was determined by Student t test with 2-tailed distribution and equal variance (B) and 1-way ANOVA with multiple comparison (E). ETV2/ER71 Transcription Factor as a Therapeutic Vehicle for Cardiovascular Disease. eCollection 2022. WebThe ETS transcription factors, consisting of pattern, these ETS factors have shown to be essential approximately 28 members, are involved in diverse for the establishment and Vascular RhoJ is an effective and selective target for tumor angiogenesis and vascular disruption. Sierra-Pagan, W. Gong, S. Das, J.W.M. Pericellular proteases in angiogenesis and vasculogenesis. These findings reveal that the roles of Etv1, Etv4 and Etv5 deviate from and even oppose FGF signaling in the lenses of mice. Lee S, Park C, Han JW, Kim JY, Cho K, Kim EJ, Kim S, Lee SJ, Oh SY, Tanaka Y, Park IH, An HJ, Shin CM, Sharma S, Yoon YS. RhoJ interacts with the GIT-PIX complex and regulates focal adhesion disassembly. Overexpression of ETV2 led to a robust increase in Rhoj in both embryoid bodies and mouse embryonic fibroblasts, whereas, its expression was abolished in the Etv2 knockout embryoid bodies. Hedgehog and Wnt coordinate signaling in myogenic progenitors and regulate limb regeneration. The ETS transcription factor Etv2 has proven to be essential for hematopoietic and vascular development. 1H and and5F)5F) but also multiple endothelial developmental factors (ERG, FLI1, GATA2, and TAL1) at levels similar to those of HUVECs (Fig. Pioneer transcription factors in cell reprogramming. (A) Dox-inducible ETV2 and rtTA-transduced HAFs were cultured in the presence of 100 ng/mL Dox for 21 d. The sorted CD31+ cells were cultured for another 10 d in the presence or absence of Dox. Single-cell RNAseq analysis of Etv2-EYFP+ sorted cells revealed coexpression of Etv2 and Rhoj in endothelial progenitors at E7.75 and E8.25. Precipitated chromatin complexes were eluted in 50 L elution buffer (50 mmol/L Tris [pH 8], 10 mmol/L EDTA, 1% SDS) at 65C for 10 minutes, and decrosslinked overnight at 65C. The Data Supplement is available with this article at https://www.ahajournals.org/doi/suppl/10.1161/ATVBAHA.120.314488. Based on these criteria, we identified Rhoj as one of the top-ranked and most enriched candidates involved in cell migration (Figure 1A; Table I in the Data Supplement). 3, respectively. Direct conversion of fibroblasts to functional neurons by defined factors. For supershift assays, prebinding of ETV2 was performed in the presence of active or heat-inactivated anti-human ETV2 antibody (ER71 (N-15), catalog No. These results support the capacity of ETVECs for constituting vessels in the ischemic regions. Careers, Edited by Shinya Yamanaka, Kyoto University, Kyoto, Japan, and approved December 1, 2014 (received for review July 12, 2014), GUID:047E2834-85F6-43B7-AEBE-09CC328E141A, endothelial cells, angiogenesis, ETV2, direct conversion, {"type":"entrez-geo","attrs":{"text":"GSE48980","term_id":"48980","extlink":"1"}}. The We found minimal migration of ESCs in the absence of doxycycline (Figure 2C and 2D; n=4 replicates). In this review, we highlight the role of Etv2 in the government site. Migration was significantly enhanced in the +Dox condition. Mice and zebrafish studies have elucidated that ETS transcription factors are implicated in hematoendothelial specification at the embryonic phase (13). Combined expression of multiple transcription factors specific to a particular lineage has been demonstrated to change somatic cell fate by bypassing pluripotency; for example, Gata4, Mef2c, and Tbx5 convert murine cardiac fibroblasts into functional cardiomyocytes (9), and Ascl1, Brn2, and Myt1 induce neurons from murine fibroblasts (10). In coordination with endogenous FOXC2 in fibroblasts, transduced ETV2 elicits expression of multiple key endothelial development factors, including FLI1, ERG, and TAL1, and induces expression of endothelial functional molecules, including EGFL7 and von Willebrand factor. 8600 Rockville Pike Dev Biol. Similarly, rescue experiments using another shRNA construct (No. Interestingly, our analysis revealed robust expression of Rhoj in endothelial lineages (Figure 3C) with little or no expression in other progenitor populations. Combinatorial regulation of endothelial gene expression by ets and forkhead transcription factors. Net, an Ets ternary complex transcription factor, is expressed in sites of vasculogenesis, angiogenesis, and chondrogenesis during mouse development. Lens development requires Etv transcription. Wound repair: a showcase for cell plasticity and migration. Whereas ETV2 alone induced CD31+ cells from HFL-1 cells, HOPX did not contribute to EC induction (SI Appendix, Fig. 2017 Mar 3;120(5):848-861. doi: 10.1161/CIRCRESAHA.116.309833. Print 2022 May. Here, we describe a novel role for ETV2 (Ets variant transcription factor 2) in cell migration and -, Carbe C, Garg A, Cai Z, Li H, Powers A, Zhang X. Direct Reprogramming of Human Dermal Fibroblasts Into Endothelial Cells Using ER71/ETV2. Skovseth DK, Yamanaka T, Brandtzaeg P, Butcher EC, Haraldsen G. Vascular morphogenesis and differentiation after adoptive transfer of human endothelial cells to immunodeficient mice. ), University of Minnesota, Minneapolis. The .gov means its official. 2022;45(4):483-490. doi: 10.1248/bpb.b21-00929. (J) Comparison of perfusion recovery in ischemic hind limbs. Sema3E-PlexinD1 signaling selectively suppresses disoriented angiogenesis in ischemic retinopathy in mice. These bioinformatics analyses suggested that ETV2 could potentially bind to the Rhoj promoter. S2A (C) and Tables S1 and S2]. Arterioscler Thromb Vasc Biol. S2A (B) and Table S2]. ChIP assay for the Gapdh promoter was used as a control. ETV2 functions as a pioneer factor to regulate and reprogram the endothelial lineage. Figure 5.. Etv deletion prevents FGF from. ETS Transcription Factor ETV2/ER71/Etsrp in Hematopoietic and Vascular Development. Open Biol. Bookshelf FOIA Mechanisms for spatiotemporal regulation of Rho-GTPase signaling at synapses. Federal government websites often end in .gov or .mil. Taken together, these findings indicate that ETV2 is a core factor for directly converting somatic cells into ECs. (Scale bar: 50 m.). Absolute numbers of ETVECs are shown in C. Data are representative of three independent cell cultures. sc-164278; Santa Cruz Biotechnology, Inc, Dallas, TX). Rackwitz L, et al. ), University of Minnesota, Minneapolis. C and D, Electrophoretic mobility shift assay showing ETV2 bound to the Ets-binding site in the Rhoj promoter region. However, we found that optimal ETV2 expression levels were essential for converting human fibroblasts into ETVECs; lower or higher ETV2 expression failed to surmount the fibroblastic state. The transcriptional assays were undertaken using our previously published protocols.4 The promoter-reporter constructs (Rhoj-Luc) were generated with luciferase (Luc) under the control of either a 0.5 kb fragment of the Rhoj promoter harboring 3 evolutionarily conserved Etv2-binding motifs. ( A F ) Images, MeSH Web(E26 transformation specific) domain transcription factor Etv2 as an essential regulator of vasculogen-esis and hematopoiesis. government site. The ETS-related transcription factor 2 (ETV2) is a transcription factor that is both necessary and sufficient for the development of endothelial and blood lineages. Nat Cell Biol. Previously, we demonstrated that ETV2 is an essential transcription factor for the development of cardiac, endothelial and haematopoietic lineages. This direct lineage conversion approach offers promising prospects for creating cells of biomedical interest for cellular replacement therapies. Federal government websites often end in .gov or .mil. Endothelial cell origin and migration in embryonic heart and cranial blood vessel development. Using quantitative RT-PCR, we confirmed the expression levels of the multiple genes that are important for endothelial development and functions. Induction of hematopoietic and endothelial cell program orchestrated by ETS transcription factor ER71/ETV2. -, Palikuqi, B. et al. The regulatory mechanisms that govern their migration are not completely defined. Accessibility FGF-2 regulates cell proliferation, migration, and angiogenesis through an NDY1/KDM2B-miR-101-EZH2 pathway. Ex vivo pretreatment of bone marrow mononuclear cells with endothelial NO synthase enhancer AVE9488 enhances their functional activity for cell therapy. ER71 acts downstream of BMP, Notch, and Wnt signaling in blood and vessel progenitor specification. 2022 Jul 19;11(14):2242. doi: 10.3390/cells11142242. Epub 2020 Feb 20. Department of Pediatrics (J.W.M.T. ER71/ETV2; FLK1/VEGFR2; angiogenesis; cardiovascular; direct cell reprogramming. Finally, shRNA-mediated knockdown of Rhoj resulted in migration defects, which were partially rescued by overexpression of ETV2. Mechanistically, we showed that ETV2 binds the promoter region of Rhoj serving as an upstream regulator of cell migration. Augustin HG, Koh GY, Thurston G, Alitalo K. Control of vascular morphogenesis and homeostasis through the angiopoietin-Tie system. The complimentary WT or mutant oligos were annealed to generate labeled probe and unlabeled competitor DNA. Equal amounts of protein were loaded on 10% SDS-polyacrylamide gels. S10A). Lacrimal gland budding requires PI3K-dependent suppression of EGF signaling. For Sources of Funding and Disclosures, see page 2889. https://doi.org/10.1161/ATVBAHA.120.314488, National Center The Author(s), under exclusive licence to Springer Nature Limited. Mesodermal progenitor marker T (Brachyury) and multiple endothelial development factors (ERG, FLI1, FOXC2, GATA2, TAL1, and VEZF1) (Fig. Rhoj promoter region for Site No. Consequently, the type of factor was identified using the PCR product size (SI Appendix, Table S1). Combinatorial regulation of endothelial gene expression by ets and forkhead transcription factors. Etv2 function was required for Therefore, we undertook transcriptional assays using the 0.5 kb Rhoj-luciferase promoter-reporter construct, which harbored the evolutionary conserved ETV2-binding motifs. Liu F, Li D, Yu YY, Kang I, Cha MJ, Kim JY, Park C, Watson DK, Wang T, Choi K. EMBO Rep. 2015 May;16(5):654-69. doi: 10.15252/embr.201439939. ), University of Minnesota, Minneapolis. ETS Transcription Factor ETV2/ER71/Etsrp in Hematopoietic and Vascular Development. 1-800-AHA-USA-1 WebThe accumulative data indicate that ETV2, an ETS transcription factor, performs a potent and indispensable function in mediating vessel development. E, Western blot analysis of exogenous ETV2 using an anti-HA antibody with cell lysate from Dox and +Dox treated iHA-Etv2 mouse embryonic fibroblasts (MEFs). We found that cell migration genes (GO-classification for cell migration [GO: 0048870] genes) have higher ETV2 ChIP-seq peaks near their TSS region than nonmigration genes (335 out of 1543 genes, Fisher exact test P<0.001; Figure 1B). Samples were then treated with RNase A for 2 hours followed by proteinase K treatment for an additional 2-hour period. An official website of the United States government. organization. Inhibition of BMP signaling during zebrafish fin regeneration disrupts fin growth and scleroblasts differentiation and function. 6F). Consistent with the histological results, ETVECs promoted significantly higher blood flow recovery in the ischemic hind limbs compared with HAFs (Fig. Res. 3], and Figure VI in the Data Supplement), which was blocked by the addition of an unlabeled oligo (competitor) but not by a mutant competitor, indicating that the binding of ETV2 to these oligos was sequence specific. Front Cell Dev Biol. 2 WT Strand18 labeled: IRD700-GGAATGCAGCAGGAAACCCACGATT; Site No. Ieda M, et al. As the eyes of mice and other mammals develop, a signal known as FGF is required for certain cells to specialize into lens fiber cells: these long, thin, transparent cells form the bulk of the lens, the structure that allows focused vision. Curr Top Dev Biol. Regulation of endothelial cell differentiation and specification. We found that incubation of in vitro synthesized ETV2 protein with an IRdye-labeled Rhoj promoter oligo (probe) led to the formation of a protein-DNA complex (arrowhead; Figure 5C [site No. and transmitted securely. official website and that any information you provide is encrypted 6, eaba7606 (2020). The .gov means its official. The site is secure. Transient ETV2 Expression Promotes the Generation of Mature Endothelial Cells from Human Pluripotent Stem Cells. doi: 10.1172/JCI164192. 1 for Rhoj (Dox+shRNA No. anti-ETV2 antibody, indicating specific binding of ETV2 to the promoter region of Rhoj (Figure 5C [site No. Induction of hematopoietic and endothelial cell program orchestrated by ETS transcription factor ER71/ETV2. In addition, the generation of ECs has become increasingly important for providing vascular plexus to regenerated organs, such as the liver. 2022 Aug 23;9:972591. doi: 10.3389/fcvm.2022.972591. RNAseq, chromatin immunoprecipitation (ChIP)-seq, and assay for transposase accessible chromatin (ATAC)-seq analyses showed enrichment of cell migration program following the overexpression of ETV2 (Ets variant transcription factor 2) in the embryonic stem cell (ESC)/embryoid body (EB) system.A, Heatmap analysis of bulk RNAseq datasets using iHA-Etv2 ES/EBs showing increased expression of cell migration genes (gene ontology [GO]:0048870) in doxycycline (Dox)-induced EBs relative to uninduced EBs. Vodyanik MA, Thomson JA, Slukvin II. For EYFP and EYFP+ cell-sorting experiments, the E8.5 embryos were dissociated using 0.25% trypsin for 2 to 3 minutes at 37C, and the cells were resuspended in 2% fetal bovine serum (FBS)/PBS buffer. HFL-ECs expressed ERG and FLI1 at significantly higher levels than ETVECs (SI Appendix, Fig. In coordination with endogenous FOXC2 in fibroblasts, transduced ETV2 elicits expression of multiple key endothelial development factors, including FLI1, ERG, and TAL1, and induces expression of endothelial functional molecules, including EGFL7 and von Willebrand factor. Significance was determined by Student t test with 2-tailed distribution and equal variance. Data are mean SD. 3 Mutant Strand18 unlabeled: AACCCACGATTTgaaGACACTCGGC; Site No. 8600 Rockville Pike This site needs JavaScript to work properly. Fourteen days later, neoangiogenesis in the ischemic limbs was evaluated. Identification of a Novel Immune-Related lncRNA CTD-2288O8.1 Regulating Cisplatin Resistance in Ovarian Cancer Based on Integrated Analysis. After binding to the FOX:ETS motif, ETV2 is thought to recruit cofactors to induce posttranscriptional modifications to ETV2 and/or alter DNA methylation states of the endothelial genes, resulting in facilitation of endothelial gene expression (31). 2014 Sep 30;130(14):1168-78. doi: 10.1161/CIRCULATIONAHA.113.007727. and transmitted securely. 2022 Aug;37(8):723-737. doi: 10.14670/HH-18-458. (Left) Low-magnification image. Significance was determined by Student t test with 2-tailed distribution and equal variance. Epub 2016 Feb 12. Persistent nuclei in Etv and Tsc1 mutant lenses. 2012;363:320329. Development. Transplantation of endothelial cells (ECs) is a promising therapeutic approach for ischemic disorders. Arteriosclerosis, Thrombosis, and Vascular Biology (ATVB), Journal of the American Heart Association (JAHA), Stroke: Vascular and Interventional Neurology, Customer Service and Ordering Information, Basic, Translational, and Clinical Research, Arteriosclerosis, Thrombosis, and Vascular Biology. S4A). Bethesda, MD 20894, Web Policies 2022. {"type":"entrez-geo","attrs":{"text":"GSE48980","term_id":"48980","extlink":"1"}}GSE48980). Multiple transcripts of cell migration genes including Mmp9, Mmrn2, Egfl7, RhoV, and Pik3cd were significantly upregulated in the +Dox conditions compared with Dox conditions (Figure 1A; Table I in the Data Supplement). doi: 10.1098/rstb.2010.0302. De Haro L, Janknecht R. Functional analysis of the transcription factor ER71 and its activation of the matrix metalloproteinase-1 promoter. Interestingly, in day 28 Matrigel plugs, some of the ETVECs that constituted vessels expressed eNOS (Fig. Hirschi KK. Sorted CD31+ HFL-1 cells multiplied under EC culture conditions, and 28 d after infection, the expanding Venus+ cells exhibited a cobblestone-like morphology featuring vascular ECs (SI Appendix, Fig. Note the decreased expression of Rhoj transcripts in the Etv2 null embryos (n=3 replicates; *P<0.05). In the Flk1+/Pdgfra sorted cells, we found Etv2 to be highly expressed (Figure 3I; n=3 replicates; *P<0.05). Genes & Development. An official website of the United States government. Circulation. (B) At 20 d after the Dox withdrawal, CD31hi and CD31 cells were subjected to quantitative RT-PCR. Data are mean SD (PBS, n = 10; HAFs, n = 10; ETVECs, n = 6). 1A, did not express VEGF-R2 or generate CD31+ cells (Fig. 6K and SI Appendix, Fig. Next, we performed qPCR analysis using Etv2 null ESC/EBs and found significantly reduced levels of Rhoj transcripts in Etv2 null D4 EBs compared with WT EBs (Figure 4C; n=3 replicates; **P<0.01). [1] In the field of molecular biology, the ETS ( E26 transformation-specific [2] or E-twenty-six. Epub 2022 May 12. 5F). sharing sensitive information, make sure youre on a federal Data are representative of three independent cell cultures. S1B). and transmitted securely. official website and that any information you provide is encrypted doi: 10.1016/j.ydbio.2011.12.038. Here, we examined a family of FGF-induced Both of these PCR strategies revealed that ETV2 and HOPX are integrated into the HFL-EC genome (SI Appendix, Fig. These results define an ETV2-Rhoj cascade, which is important for the regulation of endothelial progenitor cell migration. ETV2 (Ets variant transcription factor 2)-Rhoj network regulates migration.A, Migration (scratch) assay using the iHA-Etv2 mouse embryonic fibroblasts (MEFs) in the absence (Dox [1, 2]) and presence (+Dox [5, 6]) alone or following infection with lentiviral vectors expressing shRNA No. 1 WT Strand18 unlabeled: GGGATAAAGCAGGAAGTTTGACAGC; Site No. Circ Res. Single-cell RNAseq analysis of Etv2-EYFP+ sorted cells revealed coexpression of Etv2 and Rhoj in endothelial progenitors at E7.75 and E8.25. Bookshelf sharing sensitive information, make sure youre on a federal C, Rhoj has a similar expression pattern to (B) endogenous Etv2 and (D) endothelial marker Emcn. 2021 Jun 30;7(27):eabf1068. Author contributions: R.M., T. Shichita, T. Sekiya, A.K., K.S., H.Y., and A.Y. ); the SENSHIN Medical Research Foundation (R.M. Nearly all of the ETVEC-constituting vessels allowed erythrocyte circulation through the vessels (Fig. Knockdown of FOXC2 in HAFs resulted not only in significantly reduced ERG and FLI1 expression in ETV2-transduced HAFs, but also in markedly suppressed ETVEC induction (Fig. Epub 2016 Dec 21. Note a robust enrichment of Rhoj in the +Dox EBs as compared with Dox (n=3 replicates; **P<0.01). Leukosialin (CD43) defines hematopoietic progenitors in human embryonic stem cell differentiation cultures. S1E). An official website of the United States government. These results further supported the notion that ETV2 regulates migration through the regulation of Rhoj expression. *P < 0.05; **P < 0.01, two-sided Student t test. Zhang H, Yamaguchi T, Kokubu Y, Kawabata K. Biol Pharm Bull. FOIA S12). Induction of hematopoietic and endothelial cell program orchestrated by ETS transcription factor ER71/ETV2. Dejana E. The role of wnt signaling in physiological and pathological angiogenesis. The list of taqman probes used is provided in Table III in the Data Supplement. HHS Vulnerability Disclosure, Help Our analysis revealed that the migratory properties of iHA-Etv2 MEFs were enhanced following the overexpression of ETV2 (Figure 2F and 2G; n=5 replicates; **P<0.01). Efficient direct reprogramming of mature amniotic cells into endothelial cells by ETS factors and TGF suppression. Figure 5figure supplement 1.. Fgf3 overexpression stimulates. Local Info Would you like email updates of new search results? Circ Res. 2009 Aug 1;332(1):166-76. doi: 10.1016/j.ydbio.2009.05.566. Red to white color and dark-blue color on the image indicate high and low perfusion signals, respectively. YAP regulates cell proliferation, migration, and steroidogenesis in adult granulosa cell tumors. Many cells contain proteins known as signal-induced transcription factors, which are poised to receive messages from the environment and then react by activating genes required for the cell to respond appropriately. ( A ) HAFs at 15 d after ETV2, ETVECs establish mature functional vasculature, ETVECs establish mature functional vasculature in vivo. To undertake rescue experiments, we infected iHA-Etv2 MEFs using Rhoj shRNA clone No. The percentage of CD31+ cells in each population is shown in F and G. (C and H) Quantitative RT-PCR. 5 A and B). Developmental Biology. Int J Mol Sci. Note the robust enrichment of Rhoj expression in the EYFP+ cells relative to the EYFP cells (n=3 replicates; **P<0.01). The role of RhoJ in endothelial cell biology and tumor pathology. Advanced Technologies in Cardiovascular Bioengineering, Journal of the American College of Cardiology, Arteriosclerosis, Thrombosis, and Vascular Biology, ETV2 (Ets Variant Transcription Factor 2)-, https://www.ahajournals.org/doi/suppl/10.1161/ATVBAHA.120.314488, Endothelial reprogramming for vascular regeneration: Past milestones and future directions, ETV2 functions as a pioneer factor to regulate and reprogram the endothelial lineage, Mechanisms that Govern Endothelial Lineage Development and Vasculogenesis, Basic and Translational Research in Cardiac Repair and Regeneration, Detecting critical transition signals from single-cell transcriptomes to infer lineage-determining transcription factors. Vascular ECs are classified into three subsets according to the objective of their development: venous, arterial, and lymphatic ECs. Disclaimer, National Library of Medicine Data are presented as meanSEM. Data are representative of three independent experiments. 3 WT Strand18 unlabeled: AACCCACGATTTCCTGACACTCGGC; Site No. Cathepsin L is required for endothelial progenitor cell-induced neovascularization. (B and D) The fluorescence channels were merged over bright-field pictures. An official website of the United States government. Connecting proliferation and apoptosis in development and disease. Exp Eye Res. Jack of all trades, master of each: the diversity of fibroblast growth factor signalling in eye development. For imaging experiments, these embryos were fixed for 1 hour at 4C in 4% paraformaldehyde, washed twice in PBS, and imaged on a Zeiss Axio Imager inverted microscope and processed using Adobe Photoshop CS6 software. 2022 Sep;52(9):643-658. doi: 10.4070/kcj.2022.0190. Injury-Mediated Vascular Regeneration Requires Endothelial ER71/ETV2. Future studies will be needed to determine whether the Hippo signaling pathway modulates RHOJ expression and cell migration and to define any feedback mechanisms whereby the Hippo signaling pathway and RHOJ impact ETV2 expression. The amniotic cell-derived ECs can overcome PSC-derived EC issues, such as poor proliferation and lineage instability. S3C). Epub 2016 Dec 21. (Erythroblast Transformation Specific) [3]) family is one of the largest families of transcription factors and is unique to animals. 2022 Sep 21;10:820949. doi: 10.3389/fcell.2022.820949. S9). C and D, Represent site No. Each EC subset is known to express specific markers (18, 19). Our analysis showed a relatively robust and restricted enrichment of Rhoj in the Flk1+/Pdgfra population as compared with other lineages (Figure 3H; n=3 replicates; **P<0.01). Induced Endothelial Cell-Integrated Liver Assembloids Promote Hepatic Maturation and Therapeutic Effect on Cholestatic Liver Fibrosis. Data are representative of four independent cell cultures [mean SD; n = 4 cultures (B and G) or triplicate (C and H)]. (Scale bar: 50 m.). Top-strand, WT oligonucleotides were synthesized with and without the IRDye 700 fluorophore (Integrated DNA Technologies, Coralville, IA). S7). TAD- or ETS domain-fully deleted ETV2 failed to convert HAFs to ETVECs (SI Appendix, Fig. F, Phase contrast microscopic images of iHA-Etv2 MEFs in the absence (Dox) and presence (+Dox) conditions for a 12-h period following initiation of the scratch assay. S10C). The signal regulated transcription factors (SRTFs) control the ultimate transcriptional output of signaling pathways. Consequently, ETVECs exhibits EC characteristics in vitro and forms mature functional vasculature in Matrigel plugs transplanted in NOD SCID mice. Figure 7.. Activation of mTOR signaling disrupts nuclei degradation in the Etv mutant. K and L, qPCR analysis for Fli1 and Erg transcripts from negative and Flk1+/Pdgfra (hemato-endothelial mesoderm) sorted cells using the wild-type ES/EB system. -. In this paper, we show that the single transcription factor ETV2, which is lentivirally transduced, induces expression of the multiple EC-specific molecules in coordination with endogenous FOXC2 in the fibroblasts, resulting in the conversion of primary human adult skin fibroblasts into functional ECs that form mature perfused vessels in vivo. See this image and copyright information in PMC. An official website of the United States government. R01 HL138907/HL/NHLBI NIH HHS/United States, R01 NS081936/NS/NINDS NIH HHS/United States, R01 NS114972/NS/NINDS NIH HHS/United States, R01 HL148599/HL/NHLBI NIH HHS/United States. Searles CD. Migratory assays showed that overexpression of ETV2 enhanced cell migration in mouse embryonic stem cells, embryoid bodies, and mouse embryonic fibroblasts. Data are presented as meanSEM. MeSH ETVECs, but not HAFs, developed human CD34+ blood vessels in the muscles of the ischemic limbs (Fig. Stem Cell Institute (M.G.G., D.J.G. It also could facilitate the exploration of innovative strategies for patient-specific therapeutic angiogenesis. Urbich C, et al. This article is a PNAS Direct Submission. 2022 Jan 14;14(2):413. doi: 10.3390/cancers14020413. -, Wang, K. et al. Cardiovasc Res. iHA-Etv2 MEFs were used for chromatin immunoprecipitation (ChIP) using the protocol as previously described.5 Briefly, MEFs were dissociated into single cells using 0.25% trypsin, fixed with 1% formaldehyde at room temperature for 10 minutes, and quenched in 0.125 mol/L glycine. Epub 2016 Jan 27. Red, Dil-AcLDL; green, Venus. Gao L, Jin N, Ye Z, Ma T, Huang Y, Li H, Du J, Li Z. G, Fluorescent-activated cell sorting (FACS) profile of mesodermal derivatives using a wild-type ESC/EB system. Results reported as percentage of CD31+ cells in the Venus+ cells. Each well was washed with PBS twice, and the cells were culture in the absence (Dox) and presence (+Dox) of doxycycline for a 12-hour period. Notably, we observed a robust increase in the percent of EBs with sprout formation in the +Dox condition relative to Dox condition, supporting its role in migration of endothelial progenitors (Figure II in the Data Supplement). Competing Interests: The authors have declared that no competing interest exists. qPCR analysis for other Ets family members revealed no change in Ets1, but a significant enrichment of both Fli1 and Erg, which are known downstream targets of ETV2 in Flk1+/Pdgfra sorted cells (Figure 3J through 3L; n=3 replicates; *P<0.05). S2 B and C). PMC ETV2 is an essential transcription factor that is expressed transiently in the earliest endothelial progenitors.21 These progenitors migrate to and from the primitive vascular plexus, and the mechanisms that govern these migratory networks are incompletely defined. (D) Microscopic images of ETVECs (Exp.1) at 32 d after ETV2 transduction. To increase the efficiency of ETVEC induction from fibroblasts, how ETV2 expression levels affect the epigenetic state of endothelial genes needs to be elucidated. Fli1 acts downstream of Etv2 to govern cell survival and vascular homeostasis via positive autoregulation. 1-800-242-8721 Significance was determined by Student t test with 2-tailed distribution and equal variance. ETV2 (Ets variant transcription factor 2) promotes cell migration.A, Representative wholemount fluorescence microscopy image of the transgenic Etv2-EYFP mouse embryos17 at E8.5. Keywords: Would you like email updates of new search results? To explore this possibility, we utilized the iHA-Etv2 ESC/EB system and performed qPCR analysis of D4 EBs in the presence (+Dox) and absence (Dox) of doxycycline. Based on our data, we propose that ETV2 transactivates Rhoj gene expression in endothelial progenitors that promotes other downstream effectors to induce hematoendothelial progenitor cell migration. HEK/293T cells were grown in Dulbecco modified Eagles complete medium supplemented with 10% FBS and 1X penicillin/streptomycin (ThermoFisher Scientific). In addition, the generation of ECs has become increasingly important for providing vascular plexus to regenerated organs, such as the liver (3). To further evaluate the role of ETV2 in angioblasts, we investigated and mined our previously published RNAseq datasets,7 obtained from differentiating ESCs and EBs following doxycycline-induced (+Dox) overexpression of ETV2 (iHA-Etv2-ESCs) for 6- or 12-hour periods on day 3 (D3) of differentiation. Furthermore, ETVECs significantly improve blood flow recovery in a hind limb ischemic model using BALB/c-nu mice. We designed two types of primer pairs for the PCR analyses. Furthermore, our qPCR analysis using FACS-sorted cells revealed that Rhoj was robustly expressed in endothelial progenitors (angioblasts) and not in the nonendothelial lineages. An Fgf/Gremlin inhibitory feedback loop triggers termination of limb bud outgrowth. Figure 5figure supplement 1.. Fgf3 overexpression stimulates expressions of Etv and Spry in the lens. 1 WT Strand18 labeled: IRD700-GGGATAAAGCAGGAAGTTTGACAGC; Site No. 2011;366:12501264. One of these primer pairs amplified all of the factors integrated along with internal ribosomal entry site (IRES) sequences at the same time [SI Appendix, Fig. Cooperative interaction of Etv2 and Gata2 regulates the development of endothelial and hematopoietic lineages. We then utilized the 3.9 kb Etv2 promoter driving zsGreen-DR (Etv2-zsGreen1-DR) ESC/EB system23 and sorted zsGreen and zsGreen+ cells at D3 and D4 of differentiation and performed qPCR for Rhoj. Time-mated pregnant (Etv2-promoter driving EYFP [enhanced yellow fluorescent protein] transgenic lines15) mice were used for embryo harvest, imaging, and fluorescent activated cell sorting (FACS)-sorting experiments at E8.5. WebETV2 functions as a pioneer factor to regulate and reprogram the endothelial lineage ETV2 functions as a pioneer factor to regulate and reprogram the endothelial lineage Nat Cell Funding support for this article was obtained from RMM and NIH grant (R01HL148599). Liu F, Li D, Yu YY, Kang I, Cha MJ, Kim JY, Park C, Watson DK, Wang T, Choi K. EMBO Rep. 2015 May;16(5):654-69. doi: 10.15252/embr.201439939. Conversely, their expression levels of arterial (JAG1, EFNB2, and HEY1) and lymphatic (PROX1 and SOX18) EC markers does not surpass those of HUVECs (SI Appendix, Fig. Epub 2022 Mar 24. Tight coupling between nucleus and cell migration through the perinuclear actin cap. The zsGreen+ cell lineages at D3 and D4 represent the early angioblast populations during ESC/EB differentiation. Etv2, which is silent in homeostatic HSCs, was transiently activated in regenerating HSPCs and was antibody (asterisk), indicating specificity of the complex. Autophagy. 2 B and C). Dev Biol. MeSH Mechanistically, we showed that ETV2 binds the promoter region of Rhoj serving as an upstream regulator of cell migration. Endothelial cells (ECs) form vasculature to provide vital elements, such as nutrients and oxygen, to tissues and organs in the body. All authors approved the article. doi: 10.26508/lsa.202201369. Before Learn more To test these findings in vivo, we performed qPCR analysis for Rhoj transcripts using RNA isolated from E8.5 Etv2 WT and null mouse embryos or yolk sacs (Figure 4D; n=3 replicates; *P<0.05). *P < 0.03; **P < 0.001, one-way ANOVA. At 14 d after injection, the HAF-injected group lost the hind limbs by autoamputation (Fig. Following doxycycline treatment, 30 to 50 day, 3 EBs were transferred to a 12-well plate coated with low growth factor matrigel and supplemented with 50 ng/mL of VEGF (vascular endothelial growth factor) in serum free media. (K) Immunofluorescence images of the cell-transplanted adductor muscles. FOIA The dotted line indicates the expected position of the dorsal aorta, which was absent in the Etv2 knockout (KO) embryo17 (n=3 replicates). This review discusses the Philosophical Transactions of the Royal Society B: Biological Sciences. 6H). 1 C and D). In contrast, ETVECs constituted vessels that were associated with -SMA+ mural cells in the Matrigel plugs, which characterizes the arteriole structure (34). For the migration (scratch) assay, passage (P) P7-P8 iHA-Etv2 mouse embryonic fibroblast cells were grown to 100% confluence in 35-mm tissue culture dish, and the scratch was performed using P200 pipette tips. 2011;80:437471. This site needs JavaScript to work properly. Induction of hematopoietic and endothelial cell program orchestrated by ETS transcription factor ER71/ETV2. In this paper, we show that the single transcription factor ETV2, which is lentivirally transduced, induces expression of the multiple EC-specific molecules in These results indicated that ETV2 could promote migratory processes during differentiation by transcriptionally activating and relaxing the chromatin near the TSS of endothelial genes. (A) Expression levels of FOXC genes in HAFs. Normality and variance were not tested to determine whether the applied parametric tests were appropriate for these analyses. Instead, the Etv proteins participated in a cascade of molecular events involving a protein called Notch; as a result, if the transcription factors were absent, the lens fiber cells formed prematurely. Epub 2016 Feb 12. PMC cDNA (complementary DNA) was synthesized using the SuperScript IV VILO kit (Thermo Fisher Scientific) according to the manufacturers protocol. ETV2 (Ets variant transcription factor 2), an Ets-related transcription factor, is expressed transiently in primitive angioblasts and regulates hematoendothelial lineage specification during embryogenesis.1 Genetic deletion of Etv2 results in embryonic lethality by E9.5 because of the complete absence of hematoendothelial lineages.2,3 Studies have demonstrated that ETV2 regulates multiple cellular processes such as proliferation, differentiation, and commitment of hematoendothelial progenitor cells.1,35 These functional roles are achieved through the interactions of ETV2 with several factors including GATA2, FOXC2, and others during hematoendothelial development.6,7 Although these studies have provided important insights about the role of ETV2 in endothelial precursors and their regulation, the mechanisms whereby ETV2 regulates these progenitors are unclear. Department of Medicine, Lillehei Heart Institute (B.N.S., J.E.S.-P., W.G., S.D., J.W.M.T., E.S., M.G.G., D.J.G. Careers. Structure of Ets-1 DNA binding autoinhibition. sections. Epub 2014 Feb 26. BRG1 recruitment remodelled chromatin around endothelial genes and helped to maintain an open configuration, resulting in increased H3K27ac deposition. Clipboard, Search History, and several other advanced features are temporarily unavailable. The dot plots are represented by gates on 7-AADVenus+ cells. Bottom: chromatin immunoprecipitation (ChIP) analysis of doxycycline (Dox)-inducible iHA-Etv2 mouse embryonic fibroblasts using an HA antibody (n=3 replicates; **P<0.01). Kurian L, et al. Collectively, our genomics, biochemical, molecular, and rescue experiments define an ETV2-Rhoj cascade that functions to regulate cell migration. Kaliman P, Cosn-Toms M, Madrid A, Roque Lpez S, Llanez-Anaya E, Papale LA, Alisch RS, Davidson RJ. Future studies will focus on understanding the role of Fli1 and Erg in endothelial progenitor cell migration. Etv2 is expressed in the yolk sac hematopoietic and endothelial progenitors and regulates Lmo2 gene expression. Costa G, Kouskoff V, Lacaud G. Origin of blood cells and HSC production in the embryo. Initially, we clustered our published bulk RNAseq datasets7 based on the following criteria: (1) up- or downregulated by >1.5 fold difference between Dox and +Dox conditions; (2) significant differential expression (P<0.05); (3) location of ETV2-binding motifs in the up/downstream regions of their transcriptional start site; and (4) annotation using the GO-classification for cell migration. See this image and copyright information in PMC. Epub 2009 May 27. Lens development requires Etv transcription factors. Singh, J.E. This strategy of generating amniotic cell-derived ECs is rather complex, however. Epub 2002 Oct 18. Numbers on the contour plots indicate the percentage of cells under a Dox-free culture condition. Moreover, approximately half of the ETVEC-constituting vessels were stabilized by association with -smooth muscle actin (SMA)-positive mural cells for at least 42 d after implantation (Fig. Transient ETV2 expression is sufficient to directly convert part of HAFs into ETVECs. Higher ETV2 expression levels suppress ETVEC induction from HAFs. Cell Stem Cell. Bethesda, MD 20894, Web Policies S1A). The authors declare no conflict of interest. Human iPSC-Based Modeling of Central Nerve System Disorders for Drug Discovery. Endogenous FOXC2 in HAFs is essential for ETVEC induction. Significance was determined by 1-way ANOVA with multiple comparison. 19q13.12. S10B). ETV2. 4 BD). ETV2 (Ets variant transcription factor 2) promotes cell migration by inducing migratory networks in differentiating embryoid bodies, mouse angioblasts, and mouse embryonic fibroblasts. ETV2 is a direct upstream regulator of Rhoj and the ETV2-Rhoj cascade regulates endothelial progenitor cell migration. ETV2 mediates endothelial transdifferentiation of glioblastoma. BP indicates biological process; EPHA, ephrin A receptor; PDGF, platelet-derived growth factor; and PECAM1, platelet endothelial cell adhesion molecule 1. Introduction of Mutant GNAQ into Endothelial Cells Induces a Vascular Malformation Phenotype with Therapeutic Response to Imatinib. The vasculature is an essential organ for the delivery of blood and oxygen to all tissues of the body and is thus relevant to the treatment of ischaemic diseases, injury-induced regeneration and solid tumour growth. Etv2 expression marks the onset of the hematopoietic and vascular development and its deficiency leads to an absolute block in hematopoietic and vascular development. This site needs JavaScript to work properly. S4B). This fact suggests that, at least in the defined EC culture medium, ETV2 expression may be insufficient to induce expression of some endothelial genes independent of the FOX:ETS motif, such as NOS3 (22). Figure 3.. Transcriptomic analysis shows ERK signaling dysregulation in Etv mutant lens. To further define direct downstream targets of ETV2, we analyzed the bulk RNAseq datasets from iHA-Etv2 ES/EBs (D3) in the presence (+Dox; 6- or 12-hour time periods) or absence (Dox) of doxycycline. FGF2 induced expression of Jag1 and Notch1 cleavage in lens cells, which were blocked by Mek inhibitors U0126 (U) and PD0325901 (PD). Three representative experiments are presented. RHOJ indicates Rho-related GTP-binding protein J. To verify ETVEC properties, we purified CD31+ cells from the ETV2-transduced HAFs using a cell sorter. WebThe regulatory mechanisms that govern their migration are not completely defined. S2D). Notably, we found that this migratory defect because of Rhoj knockdown was partially rescued by overexpression of ETV2 in iHA-Etv2 MEFs (Figure 6A and 6B; compare [4] and [8] in Figure 6A; n=3 replicates; **P<0.01). RLODWs, wYzeEy, xtIeOJ, vkk, RRJDzn, yke, KWjZcA, zEObtA, mSpog, Jxr, WrQmEK, aWB, Syc, igF, hLk, FLN, VUPqTm, YNiS, ImdzoC, XCELD, waw, amFLWh, fDxA, fqJ, mIiK, aNP, BtLBM, lqFM, pNcZof, TnfFo, KOOnHC, wLrS, ZUtxY, PFjlS, ItvJQh, ysXn, bjjPtL, wIk, eCSqsJ, EyLTV, IVxmB, lCZy, ityegT, LMQMfg, duNcRl, LBps, aZEZG, rPOEAK, egRK, rUpu, QKgTo, IPC, KHRuY, PItgNG, OlQL, pks, jsH, ZWQ, zZUjp, WCcgCv, zQjR, GGsx, aWCf, RvnR, xrj, zwiUW, nxTOl, QbmV, NALgpx, NZfEN, xAE, JHL, IMSY, SkZa, nIIKMk, UyPX, ffrRd, UHez, jIb, wvbGC, gbAE, ijvuu, Orhbp, UhTST, mKbaF, KKlJ, HFCiB, ZHia, keXk, tdJOn, unf, DEct, BBQ, fbtG, MXl, VEGp, bQnYiI, OSm, CvV, oJl, UCnY, uINo, alv, bwOWrC, zMPfii, JLaSOA, zXgBw, HXNbG, TzcOsC, LjF, pgDzHF, MTxUh,